View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_152 (Length: 284)
Name: NF8902A_low_152
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_152 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 7 - 284
Target Start/End: Complemental strand, 33326371 - 33326094
Alignment:
| Q |
7 |
tttggtgttgggatgtaacgtggcgtgtcatgttggtgnnnnnnngcttcatttcttttttgaagttggtggttgtaatggaatgggtgcttgggttttc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33326371 |
tttgttgttgggatgtaacgtggcgtgtcatgttggtgtttttttgcttcatttcttttttgaagttggtggttgtaatggaatgggtgcttgggttttc |
33326272 |
T |
|
| Q |
107 |
aattccattctcaacactgctgttcttgttatttttattcatttttatgtcaggatgtattttgttggcaaaagtgaaaggagaatggttcaagagactg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33326271 |
aattccattctcaacactgctgttcttgttatttttattcatttttatgtcaggatgtattttgttggcaaaagtgaaaggagaatggttcaagagactg |
33326172 |
T |
|
| Q |
207 |
aatcaatggattgttcttcctcttgtcccgacctaatcgtcgggtcacgggcgcggtcacgatgaattgctgatgcgg |
284 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33326171 |
aatcaatggattgctcttcctcttgccctgacctaatcgttgggtcacgggcgcggtcacgatgaattgctgatgcgg |
33326094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 74 - 111
Target Start/End: Original strand, 7297197 - 7297234
Alignment:
| Q |
74 |
ggtggttgtaatggaatgggtgcttgggttttcaattc |
111 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
7297197 |
ggtgggtgtaatggaattggtgcttgggttttcaattc |
7297234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University