View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_163 (Length: 276)
Name: NF8902A_low_163
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_163 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 276
Target Start/End: Original strand, 2281768 - 2282027
Alignment:
| Q |
16 |
atgtttatccctaaaaattaaactacctccaccacttatcgaagaacattgatatttctctcacnnnnnnnnnnataaaaattatttctatcaattgaat |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
2281768 |
atgtttaaccctaaaaattaaactacctccaccacttatcgaagaacattgatatttctctcacttttttttt-ataaacattatttctatcaattgaat |
2281866 |
T |
 |
| Q |
116 |
agttatgaattgagtattaatagtactaaattaaacttaataaaatgatttaaggagggttggaggttagatgcatggatgatgcataaatttaactaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2281867 |
agttatgaattgagtattaatagtactaaattaaacttgataaaatgatttaaggagggttcgaggttagatgcatggatgatgcataaatttaactaac |
2281966 |
T |
 |
| Q |
216 |
taaccaatctttttctctatcaacttgatcaaactcaattcccttgtcaagaattctattg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2281967 |
taaccaatctttttctctatcaacttgatcaaactcaattcccttgtcaagaattctattg |
2282027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University