View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_170 (Length: 270)
Name: NF8902A_low_170
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_170 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 38322859 - 38322595
Alignment:
| Q |
1 |
ttagaaactctttctatcacttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcatcactttcgacaagtcgatatcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38322859 |
ttagaaactctttctatcacttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcattactttcgacaagtcgatatcctt |
38322760 |
T |
 |
| Q |
101 |
tgttttctttcagctgcacaaatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatttagtata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38322759 |
tgttttctttcagctgcacaaatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatatagtata |
38322660 |
T |
 |
| Q |
201 |
gaaaaatgaacctgcactttttgccaatcagggttgtactttatggctaacacatattcttggag |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
38322659 |
gaaaaatgaacctgcactttttgccaatcagggttgtactttatggctaacacattttgttggag |
38322595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University