View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_174 (Length: 269)
Name: NF8902A_low_174
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_174 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 32033359 - 32033129
Alignment:
| Q |
29 |
ttagtgcttggaaggcaaaagacaaaacgtttaacaaaa-caataatta-------ccataatcacacgaaagaatcccaaaacgtaaaaaggaaatgaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32033359 |
ttagtgcttggaaggcaaaagacaaaacgtttaacaaaaacaataattaatattgaccataatcacacgaaagaatcccaaaacgtaaaaaggaaatgaa |
32033260 |
T |
|
| Q |
121 |
aggagatggttttcgtatttttcattccaatgcttgctttatttaaagcaacaataatccatcccaagcaaatgtttgtcaagttgttaataagcttaat |
220 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
32033259 |
atgagatggttttcgtatttttcattccaatgcttgctttatttaaagcaacaataatccatcccaagcaattgtttgtcaagttgttaataagcttagt |
32033160 |
T |
|
| Q |
221 |
taagagatgaatcgtgaaagggaccttagtt |
251 |
Q |
| |
|
||| |||||||| |||||||||||||||||| |
|
|
| T |
32033159 |
taaaagatgaattgtgaaagggaccttagtt |
32033129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University