View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_175 (Length: 269)
Name: NF8902A_low_175
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_175 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 263
Target Start/End: Complemental strand, 3342371 - 3342124
Alignment:
| Q |
16 |
agcaaatgtaagccctttatattcttgataccacccactaacctgttagttaaataacacaaaagttcattaaaaatatgaataacgatgccaaaatttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3342371 |
agcaaatgtaagccctttatattcttgataccacccactaacctgttagttaaataacacaaaagttcattaaaaatatgaataacaatgccaaaatttg |
3342272 |
T |
|
| Q |
116 |
atttgttctcagaaaacctattgaatttatgatatcttaattacctgcttttcattgtaccatggactccatggcttggtgattggcaaaccaagaagat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342271 |
atttgttctcagaaaacctattgaatttatgatatcttaattacctgcttttcattgtaccatggactccatggcttggtgattggcaaaccaagaagat |
3342172 |
T |
|
| Q |
216 |
ttatgctgtatcttgttgacaatactggcactctaccatctgtgtctc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342171 |
ttatgctgtatcttgttgacaatactggcactctaccatctgtgtctc |
3342124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 263
Target Start/End: Complemental strand, 3334785 - 3334686
Alignment:
| Q |
164 |
ttttcattgtaccatggactccatggcttggtgattggcaaaccaagaagatttatgctgtatcttgttgacaatactggcactctaccatctgtgtctc |
263 |
Q |
| |
|
||||||| |||||| ||||||||| | ||||| || |||||| |||||| ||| ||||||||| ||||| | ||||||||||||||||| ||||||| |
|
|
| T |
3334785 |
ttttcatggtaccaaggactccattgtttggtaataggcaaatcaagaatgcttaagctgtatctggttgatagcactggcactctaccatcagtgtctc |
3334686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 35791538 - 35791583
Alignment:
| Q |
17 |
gcaaatgtaagccctttatattcttgataccacccactaacctgtt |
62 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| || |||||||||| |
|
|
| T |
35791538 |
gcaaatgtaagcccttgatattcttcataccatccgctaacctgtt |
35791583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University