View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_178 (Length: 267)
Name: NF8902A_low_178
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_178 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 4 - 261
Target Start/End: Original strand, 35410368 - 35410625
Alignment:
| Q |
4 |
cgcgggctggtgcatttgtcttgagtgtgtatcgcatatggggatgcaaaagcttgaatacaggatgcatcacgcttaattgccgatgagctgcaattat |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410368 |
cgcgggctgttgcatttgtcttgagtgtgtatcgcatatggggatgcagaagcttgaatacaggatgcatcacgcttaattgccgatgagctgcaattat |
35410467 |
T |
|
| Q |
104 |
taatggttccatgcatgcgtgtattcttaacctgttcggttatcataggtcaaatgtcattactaaatttctaaaacaaaggttttggtcaagtttttct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
35410468 |
taatggttccatgcatgcgtgtattcttaacctgttcggttatcataggtcaaatgtcattactaaatttctaaaacaaaagttttgggcaagtttttct |
35410567 |
T |
|
| Q |
204 |
caaatacatatatttgcatggaaatagtaattcataccaatggtgcacaagtgtatga |
261 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35410568 |
caaatacatatatttgcatggaaataataattcataccaatggtgcacaagtgtatga |
35410625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University