View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_186 (Length: 263)
Name: NF8902A_low_186
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_186 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 136 - 257
Target Start/End: Complemental strand, 27763353 - 27763232
Alignment:
| Q |
136 |
tttattatattaaagtaatacatttttaagcttaaatgtattcgttatccttgtatatttatcatatttttgcttttaatttatgttaaaagattctttt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27763353 |
tttattatattaaagtaatacatttttaagcttaaatgtattcgttatccttgtatatttatcatatttttgcttttaatttatgttaaaagattctttt |
27763254 |
T |
 |
| Q |
236 |
tgtccatcaatcatatgttttg |
257 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27763253 |
tgtccatcaatcatatgttttg |
27763232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University