View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_196 (Length: 258)
Name: NF8902A_low_196
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_196 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 15116363 - 15116156
Alignment:
| Q |
18 |
gtgttcagaccagatcagacgatgccactgagacacatgagcttaagaaacaaagtgagaatgaaatgaaaaaatgtctcaattggtgggacttgatttg |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116363 |
gtgttcagaccagatcagatgatgccactgagacacatgagcttaagaaacaaagtgagaatgaaatgaaaaaatgtctcaattggtgggacttgatttg |
15116264 |
T |
|
| Q |
118 |
gtttggctttggtgcagtaattggtgcaggaatctttgtgctaactggtcaagaagctcataaccatgcaggagcagcaatagttttatcctatgtagct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15116263 |
gtttggctttggtgcagtaattggtgcaggaatctttgtgctaactggtcaagaagctcataaccatgcaggagcagcaatagtcttatcctatgtagct |
15116164 |
T |
|
| Q |
218 |
tcaggaat |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
15116163 |
tcaggaat |
15116156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University