View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_212 (Length: 251)
Name: NF8902A_low_212
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_212 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 15 - 245
Target Start/End: Complemental strand, 38359532 - 38359303
Alignment:
| Q |
15 |
tgggggaatgttaagtgcaattgtcaaaggctctctacaccaggaatcaatccagaagttaatattttccccatttcgaatatttcaagacacattttct |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38359532 |
tgggggaatgttaagtgcagttgtcaaaggctctctacaccaggaatcaatccagaagttaatattttccccatttccaatatttcaagacacattttct |
38359433 |
T |
 |
| Q |
115 |
agcacagtagagtatttatgcctagcaccaatcaaaacagatgaagaaacatgataatcgactggnnnnnnngttccttaggatcctgcttctaatgaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
38359432 |
agcacagtagagtatttatgcctagcaccactcaaaacagatgacgaaacatgataattgactgg-ttttttgttccttaggatcctgcttctaatgaac |
38359334 |
T |
 |
| Q |
215 |
tgatcccattgtaaatctgattgcatgatat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38359333 |
tgatcccattgtaaatctgattgcatgatat |
38359303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University