View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_218 (Length: 250)
Name: NF8902A_low_218
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_218 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 30768212 - 30768443
Alignment:
| Q |
1 |
agtttgcaactacattctgaacttcttctagaggtttcagagtttgattttcgccgattggatgccatggaggaagctccgcgagcttgtcaatggaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30768212 |
agtttgcaactacattctgaacttcttctagaggtttcagagtttgattttcgctgattggatgccatggaggaagctccgcgagcttgtcaatggaaga |
30768311 |
T |
|
| Q |
101 |
ctttgctttcttgatgagccaatccactgctttgcttggtctgtcgtggccgaggcgatcttgaacatcgtagaattcgatggctgtgtgtgctgagagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30768312 |
ctttgctttcttgatgagccaatccactgctttgcttggtctgtcgtagccgaggcgatcttgaacatcgtagaattcgatggctgtgtgtgctgagagt |
30768411 |
T |
|
| Q |
201 |
cgaaccctgcgatcgcgaggaccttttgatgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30768412 |
cgaaccctgcgatcgcgaggaccttttgatgt |
30768443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 57 - 226
Target Start/End: Original strand, 39077242 - 39077411
Alignment:
| Q |
57 |
attggatgccatggaggaagctccgcgagcttgtcaatggaagactttgctttcttgatgagccaatccactgctttgcttggtctgtcgtggccgaggc |
156 |
Q |
| |
|
||||||| |||||| ||||||| | || |||||||||| |||||| || || ||||| |||||||| || ||||| || |||||||||| |||||| | |
|
|
| T |
39077242 |
attggattccatggtggaagctgatcaagtttgtcaatggcagacttagcctttttgataagccaatcaacagctttactcggtctgtcgtagccgagac |
39077341 |
T |
|
| Q |
157 |
gatcttgaacatcgtagaattcgatggctgtgtgtgctgagagtcgaaccctgcgatcgcgaggaccttt |
226 |
Q |
| |
|
| ||||||||||| ||||||| || |||||||||||||| | |||||| | ||||| ||||||||||| |
|
|
| T |
39077342 |
ggtcttgaacatcatagaattgaattgctgtgtgtgctgataatcgaacacgtcgatcacgaggaccttt |
39077411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 202
Target Start/End: Complemental strand, 22328097 - 22328000
Alignment:
| Q |
105 |
gctttcttgatgagccaatccactgctttgcttggtctgtcgtggccgaggcgatcttgaacatcgtagaattcgatggctgtgtgtgctgagagtcg |
202 |
Q |
| |
|
||||| || ||||||||||| |||||||| ||||| | ||||| |||||| |||||||| || |||||||||| || || ||||| ||||||||||| |
|
|
| T |
22328097 |
gcttttttaatgagccaatcgactgctttacttggccggtcgtagccgagacgatcttgcacgtcgtagaattgaatcgcagtgtgggctgagagtcg |
22328000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University