View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_232 (Length: 248)
Name: NF8902A_low_232
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_232 |
 |  |
|
| [»] scaffold0427 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 16088083 - 16087858
Alignment:
| Q |
17 |
ctcgaagttgcggtggctgcgttgttatttgaagatgcggttgccggttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
16088083 |
ctcgaagttgcggtggctgcgttgttatttgaagatgcggttgccggttattatttgaagttgcggtgttgcggttactgtttacgcatcaggtacaaca |
16087984 |
T |
 |
| Q |
117 |
atcttggaatttatccgtgtaactgtaaccgcaagttaaagaccttcttctacaaggtgtcccatgaaatattggtggaggatgttgatagaactatgtc |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16087983 |
atcttggaatttatccctgtaactgtaaccgcaagttaaagaccttcttctacaaggtgtcccatgaaatattggtggaggatgttgatagaactatgtc |
16087884 |
T |
 |
| Q |
217 |
agcagccaacttatacaacaatatta |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16087883 |
agcagccaacttatacaacaatatta |
16087858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 116
Target Start/End: Complemental strand, 16085160 - 16085061
Alignment:
| Q |
17 |
ctcgaagttgcggtggctgcgttgttatttgaagatgcggttgccggttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaaca |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
16085160 |
ctcgaaattgcggtggctgcgttgttatttgaagatgcggttgccgattattatttgaagttgtggtgttgcggttactgtttacgcatcaggtacaaca |
16085061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 14837170 - 14837106
Alignment:
| Q |
18 |
tcgaagttgcggtggctgcgttgttatttgaagatgcggttgccggttattatttgaagttgcggt |
83 |
Q |
| |
|
||||||||| ||| ||| |||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
14837170 |
tcgaagttgtagtgactgagttgttatttgaagttgcggttgccggttattattt-aagttgcggt |
14837106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 36 - 94
Target Start/End: Complemental strand, 3627845 - 3627786
Alignment:
| Q |
36 |
cgttgttatttgaagatgcggttgccg-gttattatttgaagttgcggtgttgcggttac |
94 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3627845 |
cgttgttatttgaagttgcggttgctacgttattatttaaagttgcggtgttgcggttac |
3627786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 155
Target Start/End: Original strand, 5659749 - 5659887
Alignment:
| Q |
18 |
tcgaagttgcggtggctgcgttgttatttgaagatgcggttgccggttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaacaa |
117 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
5659749 |
tcgaagttggggtggctacgttgttatttgaagttgcggttgcctgttattatttgaagttgcggtgttgcggttgctgtttacgcatcaggtacaacaa |
5659848 |
T |
 |
| Q |
118 |
tcttggaatttatcc-gtgtaactgtaaccgcaagttaa |
155 |
Q |
| |
|
||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
5659849 |
tcttggaatttatcctttataactgtgaccgcaagttaa |
5659887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 155
Target Start/End: Complemental strand, 38643691 - 38643570
Alignment:
| Q |
34 |
tgcgttgttatttgaagatgcggttgccg-gttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaacaatcttggaatttatcc |
132 |
Q |
| |
|
|||| ||||||| |||| ||||||||| | ||||||| || ||||||||||||||||||| | || ||||||| |||||||||||||||||||||||| |
|
|
| T |
38643691 |
tgcggtgttattcgaagttgcggttgctgcgttattacttaaagttgcggtgttgcggttgcggtttacgcat---gtacaacaatcttggaatttatcc |
38643595 |
T |
 |
| Q |
133 |
gtgt--aactgtaaccgcaagttaa |
155 |
Q |
| |
|
| | |||||| |||||||||||| |
|
|
| T |
38643594 |
ttttaaaactgtgaccgcaagttaa |
38643570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 21419084 - 21419011
Alignment:
| Q |
20 |
gaagttgcggtggctgcgttgttatttgaagatgcggttgccg-gttattatttgaagttgcggtgttgcggtt |
92 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| || | ||| | |||||||||| |||||| |||||||||||| |
|
|
| T |
21419084 |
gaagttgcggcggctgcgttgttattggaagttgtgattgttgcgttattatttaaagttgtggtgttgcggtt |
21419011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 117
Target Start/End: Complemental strand, 19033717 - 19033617
Alignment:
| Q |
17 |
ctcgaagttgcggtggctgcgttgttatttgaagatgcggttgccggttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
19033717 |
ctcgaagttgcggtggctgcgttgttatttgaagttgcggttgccggatattatttaaagttgtcgtgttgcggttactgtttacgcatcaggtacaaca |
19033618 |
T |
 |
| Q |
117 |
a |
117 |
Q |
| |
|
| |
|
|
| T |
19033617 |
a |
19033617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 155
Target Start/End: Original strand, 14059118 - 14059255
Alignment:
| Q |
20 |
gaagttgcggtggctgcgttgttatttgaagatgcggttgccg-gttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaacaat |
118 |
Q |
| |
|
||||||||| || ||||| ||||||| |||| ||||||||| | ||||||| || |||||||||||||| |||| | || ||| |||||||||||||||| |
|
|
| T |
14059118 |
gaagttgcgatgactgcgatgttattcgaagttgcggttgctgcgttattacttaaagttgcggtgttgtggttgctgtttacacatcaggtacaacaat |
14059217 |
T |
 |
| Q |
119 |
cttggaatttatcc-gtgtaactgtaaccgcaagttaa |
155 |
Q |
| |
|
|||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
14059218 |
cttggaatttatcctttataactgtgaccgcaagttaa |
14059255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 26947413 - 26947369
Alignment:
| Q |
181 |
tgaaatattggtggaggatgttgatagaactatgtcagcagccaa |
225 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26947413 |
tgaagtattggtggaggatgttgatagaactatgtcagcaaccaa |
26947369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 132
Target Start/End: Complemental strand, 53731256 - 53731143
Alignment:
| Q |
20 |
gaagttgcggtggctgcgttgttatttgaagatgcggttgccg-gttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaacaat |
118 |
Q |
| |
|
|||||||||||||||||| |||| || ||| ||||||||| | ||||||| || ||||||||||||||||||| | || ||| ||| |||||||||||| |
|
|
| T |
53731256 |
gaagttgcggtggctgcggtgttcttcaaagttgcggttgctgtgttattacttaaagttgcggtgttgcggttgctgtttacacataaggtacaacaat |
53731157 |
T |
 |
| Q |
119 |
cttggaatttatcc |
132 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
53731156 |
cttggaatttatcc |
53731143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 181 - 238
Target Start/End: Original strand, 14658272 - 14658329
Alignment:
| Q |
181 |
tgaaatattggtggaggatgttgatagaactatgtcagcagccaacttatacaacaat |
238 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||| ||| |||| |
|
|
| T |
14658272 |
tgaagtattggtggaggatgttgatagaactatgtcagcagccaaattacacagcaat |
14658329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 14655015 - 14655059
Alignment:
| Q |
181 |
tgaaatattggtggaggatgttgatagaactatgtcagcagccaa |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14655015 |
tgaagtattggtggaggatgttgatagaactatgtcagcagccaa |
14655059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 116
Target Start/End: Complemental strand, 53726774 - 53726677
Alignment:
| Q |
20 |
gaagttgcggtggctgcgttgttatttgaagatgcggttgccg-gttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaaca |
116 |
Q |
| |
|
||||||||||||| |||| |||| || ||| ||||||||| | ||||||| || ||||||||||||||||||| | || ||| ||| |||||||||| |
|
|
| T |
53726774 |
gaagttgcggtggttgcggtgttcttcaaagttgcggttgctgtgttattacttaaagttgcggtgttgcggttgctgtttacacataaggtacaaca |
53726677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 132
Target Start/End: Complemental strand, 7505038 - 7504925
Alignment:
| Q |
20 |
gaagttgcggtggctgcgttgttatttgaagatgcggttgccg-gttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaacaat |
118 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||||| | ||||||| || ||||||||||||| |||| | || ||| |||||||||||||||| |
|
|
| T |
7505038 |
gaagttgcggtggctgcggtgttattcgaagttgcggttgctgcgttattacttaaagttgcggtgttatggttgctgtttacacatcaggtacaacaat |
7504939 |
T |
 |
| Q |
119 |
cttggaatttatcc |
132 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
7504938 |
cttagaatttatcc |
7504925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 124
Target Start/End: Complemental strand, 26973397 - 26973292
Alignment:
| Q |
20 |
gaagttgcggtggctgcgttgttatttgaagatgcggttgccg-gttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaacaat |
118 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||||| | ||||||| || ||||||||||||||||||| | || ||| |||||||||||| ||| |
|
|
| T |
26973397 |
gaagttgcggtggctgcggtgttattcgaagttgcggttgctgcgttattacttaaagttgcggtgttgcggttgctgtttacacatcaggtacaagaat |
26973298 |
T |
 |
| Q |
119 |
cttgga |
124 |
Q |
| |
|
|||||| |
|
|
| T |
26973297 |
cttgga |
26973292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 116
Target Start/End: Complemental strand, 26968869 - 26968772
Alignment:
| Q |
20 |
gaagttgcggtggctgcgttgttatttgaagatgcggttgccgg-ttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaaca |
116 |
Q |
| |
|
|||||| |||||||||| ||||||| ||| ||||||||| | || ||| || ||||||||||||||||||| | || ||| |||||||||||||| |
|
|
| T |
26968869 |
gaagttccggtggctgctgtgttattcaaagttgcggttgctgcattgttacttaaagttgcggtgttgcggttgctgtttactcatcaggtacaaca |
26968772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0427 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0427
Description:
Target: scaffold0427; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 36 - 155
Target Start/End: Original strand, 5856 - 5968
Alignment:
| Q |
36 |
cgttgttatttgaagatgcggttgccggttattatttgaagttgcggtgttgcggttaccgtgtacgcatcaggtacaacaatcttggaatttatcc-gt |
134 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||| ||| ||| |||||||||||||||||||||||||| | |
|
|
| T |
5856 |
cgttgttatttgaagttgcggttgccggttattatttgaagttgcg--gttgctgtt------tacacattaggtacaacaatcttggaatttatccttt |
5947 |
T |
 |
| Q |
135 |
gtaactgtaaccgcaagttaa |
155 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
5948 |
ataactgtgaccgcaagttaa |
5968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University