View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_233 (Length: 248)
Name: NF8902A_low_233
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_233 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 236
Target Start/End: Original strand, 41550978 - 41551207
Alignment:
| Q |
7 |
aaatccaacggtgttgatgcgtggaacgaagtgcagaagaattttgataagcttgcgaaagacggttttcttcatcgcgttgatttcggtcaatgcatag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550978 |
aaatccaacggtgttgatgcgtggaacgaagtgcagaagaattttgataagcttgcgaaagacggttttcttcatcgcgttgatttcggtcaatgcatag |
41551077 |
T |
 |
| Q |
107 |
gtcaatttctttcttcaaatctcaatttatcataatcttgcaatgtttgttcaatgcatcttattcttannnnnnnnnnnngagtttctttaaatgcatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41551078 |
gtcaatttctttcttcaaatctcaatttatcataatcttgcaatgtttgttcaatgcatcttattcttattttttatttttgagtttctttaaatgcatt |
41551177 |
T |
 |
| Q |
207 |
ttagtttggtgaatttatggcctaaatatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41551178 |
ttagtttggtgaatttatggcctaaatatt |
41551207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University