View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_253 (Length: 243)
Name: NF8902A_low_253
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_253 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 38357530 - 38357728
Alignment:
| Q |
19 |
attattatcatgtgttgtatgcaactgaatgttagtcnnnnnnn--atgtcaatctgctctctcaatcccatatccccagctttatgtttcttacaatct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38357530 |
attattatcatgtgttgtatgcaactgaatgttagtctttttttttatgtcaatctgctctctcaatcccatatccccatctttatgtttcttacaatct |
38357629 |
T |
|
| Q |
117 |
atgcaaccaaaattgaactaatcaaatcgctcaaaaatattgattacaaatatccactcatttttaggccacatgtggatgtaataataaataaacaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38357630 |
atgcaaccaaaattgaactaatcaaatcgctcaaaaatattgattacaaatatccactcatttttagggcacatgtggatgtaataataaataaacaaa |
38357728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University