View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_256 (Length: 243)
Name: NF8902A_low_256
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_256 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 4054925 - 4055130
Alignment:
| Q |
19 |
gatgacccgacccaccgacccaataaccctattcggattttactttgtgtagacacttcgagagaaaaacacat-aaacacagtcaaacttcgaaacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
4054925 |
gatgacccgacccaccgacccaataaccctattcggatcttactttgtgtagacagttcgagagaaaaacacattaaacacagtgaaacttcgaaacaaa |
4055024 |
T |
|
| Q |
118 |
gagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagagaaacaaaggtattact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
4055025 |
gagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagagaaacaaagatatcact |
4055124 |
T |
|
| Q |
218 |
gttatg |
223 |
Q |
| |
|
|||||| |
|
|
| T |
4055125 |
gttatg |
4055130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University