View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_265 (Length: 242)
Name: NF8902A_low_265
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_265 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 9e-88; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 7 - 236
Target Start/End: Complemental strand, 28529769 - 28529534
Alignment:
| Q |
7 |
catgtatgtgtcggtgcttcatag----atattgagaaattacctggagaagaatgtttaagaaatatacaaaatcattcatgctgctaagcaaaacaag |
102 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28529769 |
catgcatgtgtcggtgcttcatagctagatattgagaaattacctggagaagaatgtttaagaaatatacaaaatcattcatgcttctaagcaaaacaag |
28529670 |
T |
 |
| Q |
103 |
tgtttctgtcattctccagtcgatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaat--ttacaacnnnnnnnngtagcagg |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||| |
|
|
| T |
28529669 |
tgtttctgtcattctccagtcaatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaattataacaacaaaagaaagtagcagg |
28529570 |
T |
 |
| Q |
201 |
agagtactggcattttcatattgaaatattcttcga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28529569 |
agagtactggcattttcatattgaaatatttttcga |
28529534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 106
Target Start/End: Original strand, 27926707 - 27926778
Alignment:
| Q |
35 |
tgagaaattacctggagaagaatgtttaagaaatatacaaaatcattcatgctgctaagcaaaacaagtgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||| |||| |||| | ||||| ||||| | |||||||||| |
|
|
| T |
27926707 |
tgagaaattacctggagaagaatgttcaagagatacacaatatcagttatgcttctaagtacaacaagtgtt |
27926778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 106
Target Start/End: Complemental strand, 28056486 - 28056415
Alignment:
| Q |
35 |
tgagaaattacctggagaagaatgtttaagaaatatacaaaatcattcatgctgctaagcaaaacaagtgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||| |||| |||| | ||||| ||||| | ||| |||||| |
|
|
| T |
28056486 |
tgagaaattacctggagaagaatgttcaagagatacacaacatcagttatgcttctaagtataactagtgtt |
28056415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University