View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_269 (Length: 241)
Name: NF8902A_low_269
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_269 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 24 - 233
Target Start/End: Original strand, 24301051 - 24301260
Alignment:
| Q |
24 |
ttagacatatcatattttatttccaaccctacaacctagtaaaatatctttaactttatgctcattcttgtaccaattttcatttgggcttcgaagcccg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
24301051 |
ttagacatatcatattttatttccaaccatacaacctagtaaaatatctttaactttatgctcattcttgtaccaattttcacttgggctttgaagcccg |
24301150 |
T |
|
| Q |
124 |
cagtgtgggttcggatgagcatctgtttagagctattgatgagcttttttcaactcaacgaggaaacttttcttcaacattgatcagagtccactccaac |
223 |
Q |
| |
|
||||||||||| |||| ||| |||||| |||| ||| ||||||||| | || |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24301151 |
cagtgtgggttatgatgcgcacctgtttggagccatttatgagctttcatacgcttaacggagaaacttttcttcaacattgatcagagtccactccaac |
24301250 |
T |
|
| Q |
224 |
acttccaaca |
233 |
Q |
| |
|
|||||||||| |
|
|
| T |
24301251 |
acttccaaca |
24301260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University