View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_270 (Length: 241)
Name: NF8902A_low_270
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_270 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 10 - 118
Target Start/End: Complemental strand, 48183597 - 48183489
Alignment:
| Q |
10 |
aggatgcttctatttctttatgttgaagtataattaaaaaatgtattttacttgctattctattctttttcgtttataagcctgtgaatttgacagttta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48183597 |
aggatgcttctatttctttatgttgaagtataattaaaaaatgtattttatttgctattctattcttttttgtttataagcctgtgaatttgacagttta |
48183498 |
T |
|
| Q |
110 |
acgttttag |
118 |
Q |
| |
|
|| |||||| |
|
|
| T |
48183497 |
acattttag |
48183489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 117
Target Start/End: Original strand, 20249953 - 20250005
Alignment:
| Q |
65 |
tattctattctttttcgtttataagcctgtgaatttgacagtttaacgtttta |
117 |
Q |
| |
|
|||||| |||||||| |||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
20249953 |
tattctcttctttttagtttataaacatgtgaatttgacagtttatcgtttta |
20250005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University