View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_281 (Length: 238)
Name: NF8902A_low_281
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_281 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 8348972 - 8348795
Alignment:
| Q |
1 |
gtataaagttcttggctagtctagagctttgctagttttggatggttttttcttattattgccttctacaca--ttctcttaattaagctatagttttta |
98 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
8348972 |
gtataaatttcttggctagtctacagctttgctagttttggatggtttttacttattattgcctactacacacattctcttaattaagctatagttttta |
8348873 |
T |
|
| Q |
99 |
atatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgacttttagaag |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8348872 |
atatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgacttttagaag |
8348795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 9 - 187
Target Start/End: Complemental strand, 8354998 - 8354820
Alignment:
| Q |
9 |
ttcttggctagtctagagctttgctagttttggatggttttttcttattattgccttctacacattctcttaattaagctatagtttttaatatttgatt |
108 |
Q |
| |
|
|||||||||| || | || |||||||||||||| |||||||| ||||||||||| | |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8354998 |
ttcttggctactcaatagttttgctagttttggctggtttttacttattattgcttactacacattctcttaactaagctatagtttttaatatttgatt |
8354899 |
T |
|
| Q |
109 |
tgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgacttttagaagtaggttacttt |
187 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| |||| ||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
8354898 |
tgtgagcttatagctccgcatagagaaagaaaattgctggtttttggaatggaattggcttttagaggaaggttacttt |
8354820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 66 - 165
Target Start/End: Complemental strand, 8410623 - 8410525
Alignment:
| Q |
66 |
ctacacattctcttaattaagctatagtttttaatatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattg |
165 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| |||| ||| | |||||||||| |
|
|
| T |
8410623 |
ctacacattctcttaattaagatatagtttttaatgtttgatttgtgagc-tatagctctgcatagagaaagcgaattgctggatttgggtatggaattg |
8410525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 225
Target Start/End: Complemental strand, 8361487 - 8361410
Alignment:
| Q |
148 |
ggttttgctatggaattgacttttagaagtaggttacttttctatgtcttttccttacaggtgcaactttccctattt |
225 |
Q |
| |
|
||||||| |||||| ||| |||||||| ||||||| | |||||||||||| |||||| | |||||||||||| ||||| |
|
|
| T |
8361487 |
ggttttggtatggagttggcttttagatgtaggtttcctttctatgtcttgtccttatatgtgcaactttccatattt |
8361410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 193
Target Start/End: Complemental strand, 30938628 - 30938593
Alignment:
| Q |
158 |
tggaattgacttttagaagtaggttacttttctatg |
193 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30938628 |
tggaattgacttttagaggtaggttacttttctatg |
30938593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University