View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_284 (Length: 236)
Name: NF8902A_low_284
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_284 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 28 - 212
Target Start/End: Complemental strand, 17812148 - 17811965
Alignment:
| Q |
28 |
ttcctcaccattaatccgagagctccttaccaccccgaggg-ttactcatgtccgtaccccaggcatagatggctggagaagtgaggggttcaagaagga |
126 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
17812148 |
ttcctcaccattaatccgagagctcctcaccaccccgaggggttactcatgtccgtaccccaggaatagatggctggagaagtgaggggttcaagaa--a |
17812051 |
T |
|
| Q |
127 |
gagtgtcggagcgcgtgcagtgcaggtacaccatcccccttccagtggagaagaacctgcaacagacgactcaacggaaccatgct |
212 |
Q |
| |
|
||||||| |||| | |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17812050 |
gagtgtcagagcacatgcagtgcaggtacaccaccccccttccggtggagaagaacctgcaacagacgactcaacggaaccatgct |
17811965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University