View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_286 (Length: 236)
Name: NF8902A_low_286
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_286 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 11365417 - 11365185
Alignment:
| Q |
1 |
aatatccccctattagattagaga-aagccttagaaataaattgaatgcagcatcaatatataaataatgggctccctaaatcacggtggaaaatataga |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11365417 |
aatatccccctattagattagagagaagccttagaaataaattgaatgcaacatcaatatataaataatgggctccctaaatcacggtggaaaatataga |
11365318 |
T |
|
| Q |
100 |
atatgtagctagagtcttgagacgtttcacaagaccgaaagtgacataccatagtttcaaaatttaatcatatctaccaagctactcatacccagctaag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11365317 |
atatgtagctagagtcttgagacgtttcacaagaccgaaagtgacataccatagtttcaaaatttaatcatatctaccaagctacttatacccagctaag |
11365218 |
T |
|
| Q |
200 |
agtattatgattttgcaagattataaagtataa |
232 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
11365217 |
agtattatgattttgtaagattataaagtataa |
11365185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University