View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_287 (Length: 236)
Name: NF8902A_low_287
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_287 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 17780144 - 17779928
Alignment:
| Q |
13 |
tacgtgagaaattagcgaattgaattcttttgtggacacaaggactatctagtataagttttcattcttcccagaccaagacttctcaacccctcaaaaa |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17780144 |
tacgcgagaaattagcgaattgaattcttttgtggacacaaggactatctagtataagttttcattcttcccagaccaagatttctcaacccctcaaaaa |
17780045 |
T |
|
| Q |
113 |
caaaattgactccaatcaaattttgtcaattaagcatcaataaccccac--------actaatacaacactaacatgtactttattatgccatgttttgg |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17780044 |
caaaattgattccaatcaaattttgtcaattaagcatcaataaccccacactattacactaatacaacactaacatgtactttattatgccatgttttgg |
17779945 |
T |
|
| Q |
205 |
ttttcctaataagtgat |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
17779944 |
ttttcctaataagtgat |
17779928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University