View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_291 (Length: 234)
Name: NF8902A_low_291
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_291 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 67 - 186
Target Start/End: Original strand, 56474004 - 56474123
Alignment:
| Q |
67 |
gtgaatgaagttaggtgcttgtttgtgatgttggttttggttagaagagaataaatttgattgttgatgttggtttttaactctctagcaccttaatttg |
166 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
56474004 |
gtgattgaagttaggtgcttgtttgtgatgttggttttggttagaagagaataaatttgattgttgatgttggttttcaactccctagcaccttaatttg |
56474103 |
T |
|
| Q |
167 |
aatgtggatgtttgtttgag |
186 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
56474104 |
aatgtggatgtttgtttgag |
56474123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 30579849 - 30579769
Alignment:
| Q |
1 |
tttggtgttggtggtgggtttagacaagacaagatccaatgatgctttgtttctgacagaaatgaagtgaatgaagttagg |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30579849 |
tttggtgttggtggtgggtttagacaagacaagatccaatgatgctttgtttctgacagaaatgaaatgaatgaagttagg |
30579769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University