View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_302 (Length: 232)
Name: NF8902A_low_302
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_302 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 22 - 145
Target Start/End: Complemental strand, 7345420 - 7345297
Alignment:
| Q |
22 |
atcttcgtagtaatctcttgtgacatgaacaattgtctttttattttacgttaaccctcctatttgcagaaaaggaccttgataagttggaattcgaccg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| || | || |
|
|
| T |
7345420 |
atcttcgtagtaatctcttgtgacatgaacaattgtctttttattttacgttaaccctcctatttgcagagaaggaccttgataatttggagtttggtcg |
7345321 |
T |
|
| Q |
122 |
tggatcaaaatagtccgataaaaa |
145 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7345320 |
tggatcaaaatagtccgataaaaa |
7345297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 137 - 211
Target Start/End: Complemental strand, 7345112 - 7345038
Alignment:
| Q |
137 |
cgataaaaaatgataatctgatcaaaaattgtttcgtctaagaatcaaacctactttctttcaatcaattcgtct |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
7345112 |
cgataaaaaatgataatctgatcaaagattgtttcgtctaggaatcaaacctactttctttcaatcgattcgtct |
7345038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University