View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_351 (Length: 220)
Name: NF8902A_low_351
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_351 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 7 - 214
Target Start/End: Complemental strand, 22362307 - 22362097
Alignment:
| Q |
7 |
gattattcccggctcaaaatacctgatatcggggtttttcacgtcaatcccaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatctt |
106 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22362307 |
gattattctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatatt |
22362208 |
T |
 |
| Q |
107 |
gctg---ggttcttattcatcttttctttttcatgcgttgtgtatgttagggatcaatgatggcaccacaggtgaatccaagtccaacagaatataccat |
203 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||| |
|
|
| T |
22362207 |
gctgctgggttcttattcatcttttctatttcatgcattgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagagtataccat |
22362108 |
T |
 |
| Q |
204 |
agtattaagag |
214 |
Q |
| |
|
||||||||||| |
|
|
| T |
22362107 |
agtattaagag |
22362097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University