View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_354 (Length: 219)
Name: NF8902A_low_354
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_354 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 21378359 - 21378540
Alignment:
| Q |
20 |
actatattcactccaagctatcttcagttaacctacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcc |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21378359 |
actatattcactccaagctatcttcagataacctacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcc |
21378458 |
T |
 |
| Q |
120 |
taaaaggaacttgtctcttgtttttgatactggtagtgatctcacttggactcagtgtcaaccttgtgatcgtctttgttac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
21378459 |
taaaaggaacttgtctcttgtttttgatactggtagtgatctcacttggactcagtgtcaaccttgtgctcgtccttgttac |
21378540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 43 - 187
Target Start/End: Original strand, 21404851 - 21404995
Alignment:
| Q |
43 |
tcagttaacctacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcctaaaaggaacttgtctcttgttt |
142 |
Q |
| |
|
|||| ||||||||| |||| | ||||| |||||||||| ||||||| |||||||||||| |||||||||| |||||||||| | | ||||| ||| ||| |
|
|
| T |
21404851 |
tcagctaacctaccagctaaatctggtagccttattggatcagggaattattttgttgttttagggcttggaactcctaaaaaggatttgtcacttattt |
21404950 |
T |
 |
| Q |
143 |
ttgatactggtagtgatctcacttggactcagtgtcaaccttgtg |
187 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21404951 |
ttgacactggtagtgatctcacttggactcaatgtcaaccttgtg |
21404995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University