View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_372 (Length: 207)
Name: NF8902A_low_372
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_372 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 26 - 186
Target Start/End: Original strand, 41223051 - 41223205
Alignment:
| Q |
26 |
gaatatagttccgaagacatagaatcgaaaaattctattgaattgaattgaactcctttttaatgtgaatcaatatcctgcctctgcgcacgactgcaga |
125 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||| |||| |||||||||||||||| |
|
|
| T |
41223051 |
gaatatagttccgaagacatagaatcaaaaaattctattg-----aattgaactcctttttaatgtgaatcagtatccagcctttgcgcacgactgcaga |
41223145 |
T |
|
| Q |
126 |
gactaattactcgaaccggataggatcacaaagggatcaaatctctccctctgagtatttt |
186 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41223146 |
gactaattcctcgaaccggataggatcacaaa-ggatcaaatctctccctctgagtatttt |
41223205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University