View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_375 (Length: 207)
Name: NF8902A_low_375
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_375 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 24356698 - 24356523
Alignment:
| Q |
17 |
gagtcggttggggtgggtgcatggacatagtgttggctaaaattttgaccactagattgaacttggttattagcaatgcaatatatgggacccaatttgc |
116 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24356698 |
gagtcagttggggtgggtgaatggacatagtgttggctaaaattttgaccactagattgaactgggttattagcaatgcaatatatgggacccgatttgc |
24356599 |
T |
|
| Q |
117 |
tttcgttaagggaaggca-aaaattttgatgggatccttattgttaatgaggtggttggtgagaacacgaaagtcga |
192 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |||| ||| ||||||||| |
|
|
| T |
24356598 |
tttcgttaagggaaggcaaaaaaatttgatgggatccttattgctaatgaggtggttgatgag-acaagaaagtcga |
24356523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University