View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8902A_low_381 (Length: 204)

Name: NF8902A_low_381
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8902A_low_381
NF8902A_low_381
[»] chr4 (1 HSPs)
chr4 (22-137)||(3445973-3446088)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 22 - 137
Target Start/End: Complemental strand, 3446088 - 3445973
Alignment:
22 ggtaggtgggtgaacaaattatgttttgaagcatcaaattgatttgacatcatgggaaactatagatattctttgctggctagacacagttttaatgtca 121  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
3446088 ggtaggtgggtgaacaaaatatgttttgaagcatcaaattgatttgacatcatgggaaactatagatattcttcgctggctagacacagttttaatgtca 3445989  T
122 taatcacaagtgatca 137  Q
    ||||||||||||||||    
3445988 taatcacaagtgatca 3445973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University