View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_385 (Length: 203)
Name: NF8902A_low_385
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_385 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 1109045 - 1109169
Alignment:
| Q |
1 |
gtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagatgctacagatcatgtgcagagaaatacgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| || |
|
|
| T |
1109045 |
gtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagatgctacagat---gt-cagagaaatatgt |
1109140 |
T |
|
| Q |
101 |
ataaggatgtgaagaagaaagcatatatt |
129 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
1109141 |
ataacgatgtgaagaagaaagcatatatt |
1109169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University