View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8902A_low_47 (Length: 401)

Name: NF8902A_low_47
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8902A_low_47
NF8902A_low_47
[»] chr5 (2 HSPs)
chr5 (89-201)||(42590891-42591004)
chr5 (238-347)||(42591181-42591288)


Alignment Details
Target: chr5 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 89 - 201
Target Start/End: Original strand, 42590891 - 42591004
Alignment:
89 taatggcaatcatattgggtagtgagcatagtggtgataacagaattgaagaagggcattc-cctatggaatagtgtggttaaagataatttctaactgt 187  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| ||    
42590891 taatggcagtcatgttgggtagtgagcatagtggtgataacagaattgaagaagggccttctcctatggaatagtgtggttgaagataatttctaaccgt 42590990  T
188 aatacaagctggtg 201  Q
    ||||||||||||||    
42590991 aatacaagctggtg 42591004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 238 - 347
Target Start/End: Original strand, 42591181 - 42591288
Alignment:
238 atgtttcgtgtacatcgttttaacaccattctatagacattatgttgaaatgtcgtagcatgaattgaaacggtggcttactatttgcgttgcagtgaaa 337  Q
    ||||||| |||| |||||||||||||||||  ||| ||| |  ||||||||| | ||||||||||| ||||  | |||||||||||| |||| | |||||    
42591181 atgtttcttgtatatcgttttaacaccattacatacacagt--gttgaaatgacctagcatgaattcaaacaatagcttactatttgtgttgaaatgaaa 42591278  T
338 ctttttctat 347  Q
    ||||||||||    
42591279 ctttttctat 42591288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University