View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_59 (Length: 378)
Name: NF8902A_low_59
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 22 - 321
Target Start/End: Original strand, 4306529 - 4306828
Alignment:
| Q |
22 |
gttttcgatttcacacaatccaatgctcaattgatcattacccaactccagcaaatcaattttcaatccttcaatttggcgtaaccaaatccctaatttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4306529 |
gttttcgatttcacacaatccaatgctcaattgatcattacccaactccaccaaatcaattttcaatccttcaatttggcgtaaccaaatccctaatttg |
4306628 |
T |
 |
| Q |
122 |
ttcttatgaaacccttttcatcaacaaannnnnnnnnnnnnnnnnnnnnactctgcactttttcatcctccgttttcgcagaggaggatgccaagaagaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4306629 |
ttcttatgaaacccttttcatcaacaaatcttcttctttttcttcttctactctgcactttttcatcctccgttttcgcagaggaggatgccaagaagaa |
4306728 |
T |
 |
| Q |
222 |
taatacattccgagaacgtgaagccaccgatgatgcactcggatacccagaaatgtagttactcataattgcattatttgtttcattccgttgatttagg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4306729 |
taatacattccgagaacgtgaagccaccgatgatgcactcggatacccagaaatgtagttactcataattgcattatttgtttcattccgttgatttagg |
4306828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University