View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_63 (Length: 374)
Name: NF8902A_low_63
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 8e-46; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 235 - 332
Target Start/End: Original strand, 10368687 - 10368784
Alignment:
| Q |
235 |
caacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcacccct |
332 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368687 |
caacccgtactgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcacccct |
10368784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 22 - 94
Target Start/End: Original strand, 10368474 - 10368546
Alignment:
| Q |
22 |
ctttcaattcaacggattgattgatttaatatgtcatctacaaagagcctatataaatgtcaccaaacttgtg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368474 |
ctttcaattcaacggattgattgatttaatatgtcatctacaaagagcctatataaatgtcaccaaacttgtg |
10368546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 156 - 184
Target Start/End: Original strand, 10368608 - 10368636
Alignment:
| Q |
156 |
agaaaacaaatctgaatctttgaactcca |
184 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10368608 |
agaaaacaaatctgaatctttgaactcca |
10368636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 346 - 374
Target Start/End: Original strand, 10368838 - 10368866
Alignment:
| Q |
346 |
gcgtgtgtgtgtcttaaggaacaattgtg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10368838 |
gcgtgtgtgtgtcttaaggaacaattgtg |
10368866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 260 - 328
Target Start/End: Original strand, 11659585 - 11659653
Alignment:
| Q |
260 |
attgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcac |
328 |
Q |
| |
|
|||||||||||| ||||||| |||||||| | ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11659585 |
attgaaaaggacagcaagaacaagaaggaggctactatttcaaggtatgggtttgcatttcgatctcac |
11659653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 260 - 328
Target Start/End: Original strand, 11668754 - 11668822
Alignment:
| Q |
260 |
attgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcac |
328 |
Q |
| |
|
|||||||||||| |||| ||||||||||| | ||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
11668754 |
attgaaaaggacagcaaaaagaagaaggaggctactatttcaaggtatcggtttgcatttcgatctcac |
11668822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 243 - 298
Target Start/End: Original strand, 53239235 - 53239290
Alignment:
| Q |
243 |
gctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatt |
298 |
Q |
| |
|
|||| |||||| ||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
53239235 |
gctgcagtggtctgaaaattgaaaaggacagcaagaagaagaaagaagctactatt |
53239290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 243 - 298
Target Start/End: Original strand, 2170350 - 2170405
Alignment:
| Q |
243 |
gctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatt |
298 |
Q |
| |
|
|||| |||||| ||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
2170350 |
gctgcagtggtctgaaaattgaaaaggacagcaagaagaagaaagaagctactatt |
2170405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University