View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_80 (Length: 350)
Name: NF8902A_low_80
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 30248897 - 30248764
Alignment:
| Q |
21 |
aaaagcacgaataacaacagcaatagcacacttgctttctttctatggagcaacgtgctgtgctgttcatgttattttcaacattatgattcactcgttt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
30248897 |
aaaagcacgaataacaacagcaatagcacacttgctttctttctatggagcaacgtgttgtgctgatcatgttattttcaacattataattcactcgttt |
30248798 |
T |
|
| Q |
121 |
ttggagctttggtgaaactgaagcttccaacata |
154 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
30248797 |
ttggagcattggtgaaactgaagcttccaacata |
30248764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 256 - 331
Target Start/End: Complemental strand, 30248604 - 30248529
Alignment:
| Q |
256 |
attggggagagaattatgtttgagactcaataaaggaggatttggcttttagattgaagtttgttgttgttgatat |
331 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30248604 |
attggggagagaattatgtttgagattcaataaaggaggatttggcttttagattgaagtttgttgatgttgatat |
30248529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 7e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 69 - 154
Target Start/End: Complemental strand, 21506430 - 21506345
Alignment:
| Q |
69 |
agcaacgtgctgtgctgttcatgttattttcaacattatgattcactcgtttttggagctttggtgaaactgaagcttccaacata |
154 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
21506430 |
agcaacgtgctgtgttgttcatgttattttcaacattatgattcactcgtttttggagcattggtgaaactgaagcttccatcata |
21506345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 257 - 331
Target Start/End: Complemental strand, 21506184 - 21506110
Alignment:
| Q |
257 |
ttggggagagaattatgtttgagactcaataaaggaggatttggcttttagattgaagtttgttgttgttgatat |
331 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
21506184 |
ttggggagataattatgtttgagattcaataaaggaggatttggcttttagattgaattgtgttgttgttgatat |
21506110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 21506541 - 21506497
Alignment:
| Q |
33 |
aacaacagcaatagcacacttgctttctttctatggagcaacgtg |
77 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
21506541 |
aacaacaacaaaagcacacttgctttctttctatgcagcaacgtg |
21506497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University