View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902A_low_84 (Length: 346)
Name: NF8902A_low_84
Description: NF8902A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902A_low_84 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 155 - 263
Target Start/End: Original strand, 26170220 - 26170328
Alignment:
| Q |
155 |
gaaacttaagagctaggagtggagcttttacgtgagaaaatggagttggaaaacacactctaaacatgttaggtagagagacttcataattagagtgatt |
254 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26170220 |
gaaatttaagagctaggagtggagcttttacgtgagaaaatggagttggaaaacacactctaaacatgttaggtacagagacttcataattagagtgatt |
26170319 |
T |
|
| Q |
255 |
caatctttc |
263 |
Q |
| |
|
||||||||| |
|
|
| T |
26170320 |
caatctttc |
26170328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University