View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902_high_16 (Length: 237)
Name: NF8902_high_16
Description: NF8902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 29 - 225
Target Start/End: Complemental strand, 38357728 - 38357530
Alignment:
| Q |
29 |
tttgtttatttattattacatccacatgtggcctaaaaatgagtggatatttgtaatcaatatttttgagcgatttgattagttcaattttggttgcata |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357728 |
tttgtttatttattattacatccacatgtgccctaaaaatgagtggatatttgtaatcaatatttttgagcgatttgattagttcaattttggttgcata |
38357629 |
T |
 |
| Q |
129 |
gattgtaagaaacataaagctggggatatgggattgagagagcagattgacat--nnnnnnngactaacattcagttgcatacaacacatgataataat |
225 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357628 |
gattgtaagaaacataaagatggggatatgggattgagagagcagattgacataaaaaaaaagactaacattcagttgcatacaacacatgataataat |
38357530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University