View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902_low_37 (Length: 297)
Name: NF8902_low_37
Description: NF8902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 89 - 279
Target Start/End: Complemental strand, 31212988 - 31212798
Alignment:
| Q |
89 |
ctcatatttgccaattttatcctgagctacactctctctagtgcctcgtagctatagctatcccaaactaaactatatattaaatcaatcttggaatgat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31212988 |
ctcatatttgccaattttatcctgagctacactctctctagtgcctcgtagctatagctatcccaaactaaactatatattaaatcaatcttggaatgat |
31212889 |
T |
 |
| Q |
189 |
ttttgtctccctctgtaagaggacagcataaaactagaattagaagatatttgannnnnnnnattaaatccaacacgttttaataattgtg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
31212888 |
ttttgtctccctctgtaagaggacagcataaaactagaatcagaagatatttgattttttttattaaatccaacacgttttattaattgtg |
31212798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University