View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8902_low_40 (Length: 276)
Name: NF8902_low_40
Description: NF8902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8902_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 37749838 - 37749732
Alignment:
| Q |
1 |
agatagaaatgttgtagtcttgtaagtactaagtgattttgctatatgttgtgttgactcttgtgtggagtgtagatcaagaaaaaagaagaagaaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37749838 |
agatagaaatgttgtagtcttgtaagtactaagtgattttgctatatgttgtgttgactcttgtgtggagtgtagatcaagaaaaaagaagaagaaagga |
37749739 |
T |
|
| Q |
101 |
atatgca |
107 |
Q |
| |
|
||||||| |
|
|
| T |
37749738 |
atatgca |
37749732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 156 - 264
Target Start/End: Complemental strand, 37749684 - 37749580
Alignment:
| Q |
156 |
cccccgtttgttacacttatatcatcaaaaccatatatatgttcacttatcatggcaccaactatatagaaagtggcatttatcatttcaatttttgatt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37749684 |
cccccgtttgttacacttatatcatcaaaaccatat----gttcacttatcatggcaccaactatatagaaagtggcatttatcatttcaatttttgatt |
37749589 |
T |
|
| Q |
256 |
attttagtc |
264 |
Q |
| |
|
||||||||| |
|
|
| T |
37749588 |
attttagtc |
37749580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University