View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8903_low_100 (Length: 245)
Name: NF8903_low_100
Description: NF8903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8903_low_100 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 136 - 241
Target Start/End: Complemental strand, 32610472 - 32610364
Alignment:
| Q |
136 |
cagcacataatccttgtaaaacggttgttgattgtccacctc---atccgtatagttttgttgttactgttaagtgtgttcgtcgcttgtgtatatatga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
32610472 |
cagcacataatccttgtaaaacggttgttgattgtccacctcctcatccgtatggttttgttgttgctgttaagtgtgttcgtcgcttgtgtatatataa |
32610373 |
T |
|
| Q |
233 |
tgtccatct |
241 |
Q |
| |
|
||| ||||| |
|
|
| T |
32610372 |
tgtacatct |
32610364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 5 - 89
Target Start/End: Complemental strand, 32610602 - 32610518
Alignment:
| Q |
5 |
tcgcaacggtatctggtaagcannnnnnncatccttttcaaattacattatttactttgtagttcgtaaatcatacacaatagat |
89 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32610602 |
tcgcaacggtatctggtaagcaattttttcatccttttcaaattacattatttactttgtagtttgtaaatcatacacaatagat |
32610518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University