View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8903_low_106 (Length: 242)
Name: NF8903_low_106
Description: NF8903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8903_low_106 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 242
Target Start/End: Original strand, 49788646 - 49788869
Alignment:
| Q |
20 |
tacattgcatacaatacccaacattctgcaactacatggcattaagatttccttttttacttattaagattgttctttaatcacatccccaaatgcaata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49788646 |
tacattgcatacaatacccaacattctgcaactacatggcattaagatttccttttttacttattaagattgttctttaatcacatccccaaatgcaata |
49788745 |
T |
 |
| Q |
120 |
ttgtcatttttcgttcaacctaattc-aannnnnnnnnnnactgaacctaattcaaatgatccaatggagttagtacatttaaacgttttacaactcgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49788746 |
ttgtcatttttcgttcaacctaattcaaattattttttttactgaacctaattcaaatgatccaatggagttagtacatttaaacgttttacaactcgaa |
49788845 |
T |
 |
| Q |
219 |
atggagaaaattattgtctctgct |
242 |
Q |
| |
|
||||||||||||||| || ||||| |
|
|
| T |
49788846 |
atggagaaaattattatccctgct |
49788869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University