View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8903_low_109 (Length: 236)
Name: NF8903_low_109
Description: NF8903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8903_low_109 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 105 - 220
Target Start/End: Original strand, 37563586 - 37563701
Alignment:
| Q |
105 |
cataaataaacaacgttagacccttctgaactcaaaatattcttgggccctcttgtggttgtgaaagagcctttttgttcactttgatggtcccaactat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37563586 |
cataaataaacaacgttagacccttctgaactcaaaatattcttgggccctcttgtggttgtgaaagagcttttttgttcactttgatggtcccaactat |
37563685 |
T |
 |
| Q |
205 |
tagctgataaaaaatg |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37563686 |
tagctgataaaaaatg |
37563701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 37563482 - 37563517
Alignment:
| Q |
1 |
aatgttttttacaaaccagcttctgcaagagggacc |
36 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37563482 |
aatgttttttacaaactagcttctgcaagagggacc |
37563517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University