View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8903_low_92 (Length: 256)
Name: NF8903_low_92
Description: NF8903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8903_low_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 25 - 165
Target Start/End: Complemental strand, 20132516 - 20132376
Alignment:
| Q |
25 |
acaaagtgtttggaacaccgtaaacttcaaaatatatcattacgttttatatcatcattgtagcaatatgcaatgcagaaaagtgatatttcaaaaactt |
124 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20132516 |
acaaagtgtttgggacaccctaaacttcaaaatatatcattacgttttatatcatctttgtagtaatatgcaatgcagaaaagtgatatttcaaaaactt |
20132417 |
T |
 |
| Q |
125 |
ttcatgtaaggtttttgacatcacatacgcaacacaattcg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20132416 |
ttcatgtaaggtttttgacatcacatacgcaacacaattcg |
20132376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University