View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8903_low_98 (Length: 252)
Name: NF8903_low_98
Description: NF8903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8903_low_98 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 252
Target Start/End: Original strand, 8202760 - 8202996
Alignment:
| Q |
20 |
agcaccattctcatctgaatcttcctcatcaccatggagaagaaggttacaaaaatgacgatttgcgccttggttgagcagctgaattaatggaaccaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8202760 |
agcaccattctcatctgaatcttcctcatcaccatggagaagaaggttacaaaaatgacgatttgcgccttggttgagcaactgaattaatggaaccaat |
8202859 |
T |
 |
| Q |
120 |
gtcatgttaaatttgcttgaattagacattgtaaattaattaagc----agctagcacttgttaagttgttatttaagctttaattagtttgtaatctcg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
8202860 |
gtcatgttaaatttgcttgaattagacattgtaaattaattaagcagctagctagcacttgttaagttgttatttgagctttaattagtttgtaatatca |
8202959 |
T |
 |
| Q |
216 |
tattaaaccaaaagttggttccaaactctccatctag |
252 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
8202960 |
cattaaacctaaagttggttccatactctccatctag |
8202996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University