View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8904_low_22 (Length: 283)
Name: NF8904_low_22
Description: NF8904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8904_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 17 - 278
Target Start/End: Original strand, 7407891 - 7408152
Alignment:
| Q |
17 |
agtaattgtataaaaaagaaaaattacaagagtgagnnnnnnngaagggatagagtgccttttttgtccctta-ggcttaactgagttgactatgnnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7407891 |
agtaattgtataaaaaagaaaaattacaagagtgagaaaaaaagaagggatagagtgccttttttgtcccttttggcttaactgagttgactatgatata |
7407990 |
T |
|
| Q |
116 |
nnnnnnnnnnnnnnnngagtcgaggtttaaacctcagattcttaatttactcacttaaaaagatgtgaaattataaccacctaactatttgattnnnnnn |
215 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
7407991 |
acattatatatgtat-gagtcgaggtttaaaccccaaattcttaatttactcatttaaaaagatgtaaaattataaccaccaaactatttgattaaaaaa |
7408089 |
T |
|
| Q |
216 |
ngtctgcaagtttttcaaaggttggtattttgaacttgcaaatctgcatcgtgtttagtctct |
278 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7408090 |
agtctgcaagtttttcaaaggtcggtattttgaacttgcaaatctgcatcgtgtttagtctct |
7408152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University