View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8904_low_31 (Length: 231)
Name: NF8904_low_31
Description: NF8904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8904_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 30348185 - 30347979
Alignment:
| Q |
11 |
cagagatacaaccagctgagaaaggaagaataacaagcctttccattctctgtctcattctttcttaggataggtgaatatctcaattggaatt-ggagc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
30348185 |
cagagatacaaccagctgagaaaggaagaatgacaagcctttccattctctgtctcattatttcttaggaaaggtgaatatctcaattggaatttggagc |
30348086 |
T |
 |
| Q |
110 |
ttaattaattgatccaccaaaaaatgcaacccttgaatggagatataacaactacaatatatagatatagatagatagctattcaagttatattgtagtt |
209 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30348085 |
tgaattaattgatccaccaaaaaatgcaacccttgaatggagatataacaactacaatatatagatatagatagatagctattcaagttatattgtagtc |
30347986 |
T |
 |
| Q |
210 |
ataatat |
216 |
Q |
| |
|
||||||| |
|
|
| T |
30347985 |
ataatat |
30347979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University