View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_high_16 (Length: 293)
Name: NF8905A_high_16
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_high_16 |
 | |
|
| [»] scaffold1075 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 17006293 - 17006016
Alignment:
| Q |
1 |
tgatattatccaacacatttttctcaatatgcatcgggtcaagattatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17006293 |
tgatattatccaacacatttttctcgatatgcatcgggtcaagattatgacgcaaaagattgtccttccaatatggaagttcaaagaatatgcttttctt |
17006194 |
T |
|
| Q |
101 |
cttccagattggagggtcatcttttgtagattgcctcttgcctttccnnnnnnnnnctggtttggagggtcaccttgtgtaggttgtttcttgccttttc |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17006193 |
cttctagattggagggtcatcttttgtagattgcctcttgcctgtcc--tttttttctggtttggagggtcaccttgtgtaggttgtttcttgccttttc |
17006096 |
T |
|
| Q |
201 |
tttttcccaaccctgctttctttggctttttaccaaaaatgacctttatgttttcaacatgttcaagaacttgatgtcca |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
17006095 |
tttttcccaaccctgctttctttggctttttaccaaaaatgacctttatgttttcaacctgttgaagaacttgatgtcca |
17006016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1075 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold1075
Description:
Target: scaffold1075; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 2804 - 3050
Alignment:
| Q |
1 |
tgatattatccaacacatttttctcaatatgcatcgggtcaagattatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2804 |
tgatattatccaacacatttttctcgatatgcatcgggtcaagattatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttctt |
2903 |
T |
|
| Q |
101 |
cttccagattggagggtcatcttttgtagattgcctcttgcctttccnnnnnnnnnctggtttggagggtcaccttgtgtaggttgtttcttgccttttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2904 |
cttccagattggagggtcatcttttgtagattgcctcttgcctgtcc--tttttttctggtttggagggtcaccttgtgtaggttgtttcttgccttttc |
3001 |
T |
|
| Q |
201 |
tttttcccaaccctgctttctttggctttttaccaaaaatgacctttat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002 |
tttttcccaaccctgctttctttggctttttaccaaaaatgacctttat |
3050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University