View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_high_25 (Length: 235)
Name: NF8905A_high_25
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 22 - 208
Target Start/End: Original strand, 35679141 - 35679327
Alignment:
| Q |
22 |
cacaattatgcaagttttggatcgctatgcagcatattatatatcaatcacctggaaactagctttggtacctctacaatcaaaattgcatgaacttaat |
121 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35679141 |
cacaattatgcaaattttggatcgctatgcagcatattatatatcaatcacctgcaaactagctttggtacctctacaatcaaaattgcatgaacttaat |
35679240 |
T |
 |
| Q |
122 |
gatgaaccaccgcaattaaaaaccacagcaaagaaaaatgcccagccacacatccaacataattgctccacttgctaaacacaaaga |
208 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35679241 |
gatgaaccgccgcaattaaaaaccacaccaaagaaaaatgcccagccacacatccaacattattgctccacttgctaaacacaaaga |
35679327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University