View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_151 (Length: 260)
Name: NF8905A_low_151
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_151 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 245
Target Start/End: Complemental strand, 11565736 - 11565499
Alignment:
| Q |
8 |
gagtgaaatgaacggatagagattagatcgagggtgggaaatggtgcatagacatgaacgacggaaatggcgcagattgtggtgagttatggggaacaga |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11565736 |
gagtgaaatgaacggatagatattagatcgagggtgggaaatggtgcatagacatgaacgacggaaatggcgcagattgtggtgagtaatggggaacaga |
11565637 |
T |
 |
| Q |
108 |
ggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttcacgtgaatggatagataataggtattgataactgattgagtaaagaagaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565636 |
ggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttcacgtgaatggatagataataggtattgataactgattgagtaaagaagaaa |
11565537 |
T |
 |
| Q |
208 |
caagtgtttaattccaacaatttgtagtgcacttgcat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565536 |
caagtgtttaattccaacaatttgtagtgcacttgcat |
11565499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University