View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_181 (Length: 250)
Name: NF8905A_low_181
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_181 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 2 - 181
Target Start/End: Original strand, 31717816 - 31717999
Alignment:
| Q |
2 |
ctggtatcctatttgggacgaagtgttcaaatcccatttgagtgatccggagctggctttgctccgggtcgcagtgaaggataaagataaggcatcagat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31717816 |
ctggtatcctatttgggacgaagtgttcaaatcccgtttgagtgatccggagctcgctttgctccggatcgcagtgaaggataaagataaggcatcagat |
31717915 |
T |
|
| Q |
102 |
gagagaagaattttggtttgttgctttgtgcgacagaaagggaaagaaatataattc----tgtcaagcttttgcttcttttcc |
181 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31717916 |
gagacaaggattttggtttgttgctttgtgcgacagaaagggaaagaaatataattaattatgtcaagcttttgcttcttttcc |
31717999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 172 - 249
Target Start/End: Complemental strand, 31718123 - 31718045
Alignment:
| Q |
172 |
cttcttttcccccaagcttcttcatcttgcaacgaccttttagata-agatgcttctagaaaagaaaaccgtgaatata |
249 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||| ||||||| || ||||| |
|
|
| T |
31718123 |
cttcttttcccccaagtttcttcatcttgcaatgaccttttagatacagatgcttctagaaaggaaaaccttgtatata |
31718045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 31654383 - 31654442
Alignment:
| Q |
111 |
attttggtttgttgctttgtgcgacagaaagggaaagaaatataattctgtcaagctttt |
170 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31654383 |
atttcggtctgttgctttgtgtgacagaaagggaaagaaatataactctgtcaagctttt |
31654442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 31704751 - 31704810
Alignment:
| Q |
111 |
attttggtttgttgctttgtgcgacagaaagggaaagaaatataattctgtcaagctttt |
170 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31704751 |
atttcggtctgttgctttgtgtgacagaaagggaaagaaatataactctgtcaagctttt |
31704810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 3 - 100
Target Start/End: Original strand, 31654237 - 31654334
Alignment:
| Q |
3 |
tggtatcctatttgggacgaagtgttcaaatcccatttgagtgatccggagctggctttgctccgggtcgcagtgaaggataaagataaggcatcaga |
100 |
Q |
| |
|
||||||||| |||||||||||| |||| ||| ||| |||| || ||| ||||| || ||||||||| ||| |||||| ||||||||||||| |||||| |
|
|
| T |
31654237 |
tggtatcctgtttgggacgaagagttcgaattccaattgactgttccagagcttgcattgctccggatcgaagtgaaagataaagataagggatcaga |
31654334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University