View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_19 (Length: 420)
Name: NF8905A_low_19
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 9 - 408
Target Start/End: Complemental strand, 9339958 - 9339559
Alignment:
| Q |
9 |
aatgagaaaacaattacttaccctcatcttgtgcaacaatattattgaagtactgctcatcagagaacttgatttcagggtgataacttcgattaggtgt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9339958 |
aatgagaaaacaattacttaccctcatcttgtgcaccaatattattgaagtactgctcatcagagaacttgatttcagggtgataacttcgattaggtgt |
9339859 |
T |
 |
| Q |
109 |
ttgggatggaataccaacactggatgtagaaccgggtcgggatgaagaccatggttgctcgtcagcaaaagaagacccattatagtcaaatgaatttaca |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9339858 |
ttgggaaggaataccaacactggatgtagaaccgggtcgggatgaagaccatggttgatcgtcagcaaaagaagacccattatagtcaaatgaatttaca |
9339759 |
T |
 |
| Q |
209 |
tcaacttttaggtttcttccaatggcatcagatggttctgactgattaaccatgttactatcagaacctaaccctgtgttaactctcagatgaggcataa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9339758 |
tcaacttttaggtttcttccaatggcatcagatggttctgactgattaaccatgttactatcagaacctaaccctgtgttaactctcagatgaggcataa |
9339659 |
T |
 |
| Q |
309 |
cgtcaccaagttcttgaaaaggagatccttctggggcatctgacgagcgaacaggcaagtcgatcccnnnnnnnccttgttcaaaccacaaaatgatgtc |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9339658 |
tgtcaccaagttcttgaaaaggagatccttctggggcatctgaagagcgaacaagcaagtcgatcccaaaaaaaccttgttcaaaccacaaaatgatgtc |
9339559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University