View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_208 (Length: 246)
Name: NF8905A_low_208
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_208 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 10312984 - 10313215
Alignment:
| Q |
14 |
agatgaactgtatttgtaacaagtgagtgagtgtgt-aggtttatatatttgggtttaacacacaacggtattataagggtacttgcttggaaacaacgg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10312984 |
agatgaactgtatttgtaacaagtgagtgagtgagttaggtttatatatttgggtttaacactcaacggtattataagggtacttgcttggaaacaacgg |
10313083 |
T |
 |
| Q |
113 |
cacttaagtatttctccttttgcatatgaaatccaaacccaactctatttgttttatgggaataaccatgtagtgcttcccaagattcttttgagaggaa |
212 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
10313084 |
cacttaagtattttcccgtttgcatatgaaatccaaacccaaccctatttgttttatgggaataaccttgtagtgcttcataagattcttttgagaggaa |
10313183 |
T |
 |
| Q |
213 |
taagattgtatcattgcattatttaacaatgg |
244 |
Q |
| |
|
||| ||||||||||| |||||||||| ||||| |
|
|
| T |
10313184 |
taaaattgtatcatttcattatttaaaaatgg |
10313215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University